Trimmomatic performs a variety of useful trimming tasks for illumina paired-end and single ended data.The selection of trimming steps and their associated parameters are supplied on the command line. Trimmomatic was developed at the Usadel lab in Aachen, Germany.

The current trimming steps are:

• ILLUMINACLIP: Cut adapter and other illumina-specific sequences from the read.
• SLIDINGWINDOW: Perform a sliding window trimming, cutting once the average quality within the window falls below a threshold.
• LEADING: Cut bases off the start of a read, if below a threshold quality
• TRAILING: Cut bases off the end of a read, if below a threshold quality
• CROP: Cut the read to a specified length
• HEADCROP: Cut the specified number of bases from the start of the read
• MINLEN: Drop the read if it is below a specified length
• TOPHRED33: Convert quality scores to Phred-33
• TOPHRED64: Convert quality scores to Phred-64

It works with FASTQ (using phred + 33 or phred + 64 quality scores, depending on the Illumina pipeline used), either uncompressed or gzipp'ed FASTQ. Use of gzip format is determined based on the .gz extension.

For single-ended data, one input and one output file are specified, plus the processing steps. For paired-end data, two input files are specified, and 4 output files, 2 for the 'paired' output where both reads survived the processing, and 2 for corresponding 'unpaired' output where a read survived, but the partner read did not.

Use the modules commands to set up trimmomatic, as in the example below. The module sets environment variables called 'TRIMMOJAR' and 'TRIMMOMATIC_JAR' which point to the location of the trimmomatic java file. The variable 'TRIMMOMATIC_JARPATH' points to the directory in which the trimmomatic jar file is located.

Fasta files of adapter sequences are included with trimmomatic and can be found at /usr/local/apps/trimmomatic/<version>/adapters

References:

• Bolger et al.,Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics (2014). Link

• Trimmomatic Main Site

• Module Name: trimmomatic (see the modules page for more information)
• Multithreaded
• environment variables set
  • $TRIMMOJAR
• Reference data in /usr/local/apps/trimmomatic/<version>/adapters

Allocate an interactive session and run the program. Sample session:

[user@biowulf]$ sinteractive --mem 10g
salloc.exe: Pending job allocation 46116226
salloc.exe: job 46116226 queued and waiting for resources
salloc.exe: job 46116226 has been allocated resources
salloc.exe: Granted job allocation 46116226
salloc.exe: Waiting for resource configuration
salloc.exe: Nodes cn3144 are ready for job

[user@cn3144 ~]$ module load trimmomatic

[user@cn3144 ~]$ java -jar $TRIMMOJAR PE -phred33 \
    /fdb/app_testdata/fastq/H_sapiens/hg100_1m_pe1.fq.gz /fdb/app_testdata/fastq/H_sapiens/hg100_1m_pe2.fq.gz \
    output_forward_paired.fq.gz output_forward_unpaired.fq.gz \
    output_reverse_paired.fq.gz output_reverse_unpaired.fq.gz \
    ILLUMINACLIP:/usr/local/apps/trimmomatic/0.39/adapters/TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
TrimmomaticPE: Started with arguments:
 -phred33 /fdb/app_testdata/fastq/H_sapiens/hg100_1m_pe1.fq.gz /fdb/app_testdata/fastq/H_sapiens/hg100_1m_pe2.fq.gz out1 out2 out3 out4 ILLUMINACLIP:/usr/local/apps/trimmomatic/0.39/adapters/TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Multiple cores found: Using 2 threads
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 1000000 Both Surviving: 964918 (96.49%) Forward Only Surviving: 25517 (2.55%) Reverse Only Surviving: 7780 (0.78%) Dropped: 1785 (0.18%)
TrimmomaticPE: Completed successfully

[user@cn3144 ~]$ exit
salloc.exe: Relinquishing job allocation 46116226
[user@biowulf ~]$

Create a batch input file (e.g. trimmomatic.sh). For example:

#!/bin/bash

ml trimmomatic || exit 1
java -Djava.io.tmpdir=. -jar $TRIMMOJAR PE -phred33 -threads $SLURM_CPUS_PER_TASK \
    SRR292678_1.fastq.gz SRR292678_2.fastq.gz \
    output_forward_paired.fq.gz output_forward_unpaired.fq.gz \
    output_reverse_paired.fq.gz output_reverse_unpaired.fq.gz \
    ILLUMINACLIP:/usr/local/apps/trimmomatic/0.39/adapters/TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 \
    SLIDINGWINDOW:4:15 MINLEN:36

Submit this job using the Slurm sbatch command.

sbatch -c 2 --mem=6g trimmomatic.sh

Create a swarmfile (e.g. trimmomatic.swarm). For example:

java -Djava.io.tmpdir=. -jar $TRIMMOJAR PE -phred33 -threads $SLURM_CPUS_PER_TASK \
    /fdb/app_testdata/fastq/H_sapiens/hg100_1m_pe1.fq.gz /fdb/app_testdata/fastq/H_sapiens/hg100_1m_pe2.fq.gz \
    output_forward_paired.fq.gz output_forward_unpaired.fq.gz \
    output_reverse_paired.fq.gz output_reverse_unpaired.fq.gz \
    ILLUMINACLIP:/usr/local/apps/trimmomatic/0.39/adapters/TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 \
    SLIDINGWINDOW:4:15 MINLEN:36
[...etc....]

Submit this job using the swarm command.

swarm -f trimmomatic.swarm -g 6 -t 8 --module trimmomatic