Path to Bowtie 2 specified as: bowtie2 Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/apps/samtools/1.3.1/bin/samtools' Reference genome folder provided is XandY/ (absolute path is '/spin1/users/user/bismark_test/XandY/)' FastQ format assumed (by default) Files to be analysed: test_data.fastq Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Current working directory is: /spin1/users/user/bismark_test Now reading in and storing sequence information of the genome specified in: /spin1/users/user/bismark_test/XandY/ chr chrX (155270560 bp) chr chrY (59373566 bp) Single-core mode: setting pid to 1 Single-end alignments will be performed ======================================= Input file is in FastQ format Writing a C -> T converted version of the input file test_data.fastq to test_data.fastq_C_to_T.fastq Created C -> T converted version of the FastQ file test_data.fastq (10000 sequences in total) Input file is test_data.fastq_C_to_T.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /spin1/users/user/bismark_test/XandY/ with the specified options: -q --score-min L,0,-0.2 --ignore-quals Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from test_data.fastq_C_to_T.fastq with options -q --score-min L,0,-0.2 --ignore-quals --norc) Using Bowtie 2 index: /spin1/users/user/bismark_test/XandY/Bisulfite_Genome/CT_conversion/BS_CT Found first alignment: SRR020138.15024316_SALK_2029:7:100:1672:1790_length=86 4 * 0 0 * * 0 0 TTTTTAGAAAGTTTATATGGAAATTAAGTTTTTTGTATATGTTTGTAAAG BCB?).4'324&1;B################################### YT:Z:UU Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from test_data.fastq_C_to_T.fastq with options -q --score-min L,0,-0.2 --ignore-quals --nofw) Using Bowtie 2 index: /spin1/users/user/bismark_test/XandY/Bisulfite_Genome/GA_conversion/BS_GA Found first alignment: SRR020138.15024316_SALK_2029:7:100:1672:1790_length=86 4 * 0 0 * * 0 0 TTTTTAGAAAGTTTATATGGAAATTAAGTTTTTTGTATATGTTTGTAAAG BCB?).4'324&1;B################################### YT:Z:UU >>> Writing bisulfite mapping results to test_data_bismark_bt2.bam <<< Reading in the sequence file test_data.fastq 10000 reads; of these: 10000 (100.00%) were unpaired; of these: 9446 (94.46%) aligned 0 times 191 (1.91%) aligned exactly 1 time 363 (3.63%) aligned >1 times 5.54% overall alignment rate 10000 reads; of these: 10000 (100.00%) were unpaired; of these: 9451 (94.51%) aligned 0 times 194 (1.94%) aligned exactly 1 time 355 (3.55%) aligned >1 times 5.49% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary file test_data.fastq_C_to_T.fastq Final Alignment report ====================== Sequences analysed in total: 10000 Number of alignments with a unique best hit from the different alignments: 378 Mapping efficiency: 3.8% Sequences with no alignments under any condition: 9267 Sequences did not map uniquely: 355 Sequences which were discarded because genomic sequence could not be extracted: 0 Number of sequences with unique best (first) alignment came from the bowtie output: CT/CT: 205 ((converted) top strand) CT/GA: 173 ((converted) bottom strand) GA/CT: 0 (complementary to (converted) top strand) GA/GA: 0 (complementary to (converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 3258 Total methylated C's in CpG context: 88 Total methylated C's in CHG context: 4 Total methylated C's in CHH context: 13 Total methylated C's in Unknown context: 0 Total unmethylated C's in CpG context: 108 Total unmethylated C's in CHG context: 777 Total unmethylated C's in CHH context: 2268 Total unmethylated C's in Unknown context: 0 C methylated in CpG context: 44.9% C methylated in CHG context: 0.5% C methylated in CHH context: 0.6% Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0 ==================== Bismark run complete ====================