Nascent RNA Sequencing Reveals Widespread Pausing and Divergent Initiation at Human Promoters
Science, 19 Dec 2008: Vol. 322, Issue 5909, pp. 1845-1848. DOI: 10.1126/science.1162228
Precise Maps of RNA Polymerase Reveal How Promoters Direct Initiation and Pausing
Science, 22 Feb 2013: Vol. 339, Issue 6122, pp. 950-953. DOI: 10.1126/science.1229386
Identification of active transcriptional regulatory elements from GRO-seq data
Nature Methods,12, pages 433–438 (2015)
Documentation
Important Notes
- Module Name: proseq (see the modules page for more information)
- Unusual environment variables set
- PROSEQ_HOME installation directory
- PROSEQ_BIN executable directory
- PROSEQ_SRC source code directory
- PROSEQ_DATA sample data directory
Interactive job
Interactive jobs should be used for debugging, graphics, or applications that cannot be run as batch jobs.
Allocate an interactive session and run the program. Sample session:
[user@biowulf]$ sinteractive [user@cn3335 ~]$module load proseq [+] Loading cutadapt 1.18 [+] Loading fastxtoolkit 0.0.14 ... [+] Loading seqtk 1.3 [+] Loading bwa 0.7.17 on cn3613 [+] Loading samtools 1.9 ... [+] Loading bedops 2.4.35 [+] Loading bedtools 2.27.1 [+] Loading prinseq, version 0.20.4... [+] Loading proseq 2.0Download proseq sample data from a system folder to the current folder:
[user@cn3335 ~]$cp $PROSEQ_DATA/* . [user@cn3335 ~]$ls mm10.chromInfo test_R1.fastq.gz test_R2.fastq.gz test_SE.fastq.gzProseq is capable of processing both single-read data, as examplified by the sample file test_SE.fastq.gz, and paired-end data, as exaified by the files test_R1.fastq.gz and test_R2.fastq.gz:
[user@cn3335 ~]$proseq2 --help
Preprocesses and aligns PRO-seq data.
Takes PREFIX.fastq.gz (SE), PREFIX_R1.fastq.gz, PREFIX_R2.fastq.gz (PE)
or *.fastq.gz in the current working directory as input and writes
BAM and bigWig files as output to the user-assigned output-dir.
Requirements in current working directory:
cutadapt 1.8.3, fastx_trimmer, seqtk, prinseq-lite.pl 0.20.2, bwa, samtools, bedtools, and bedGraphToBigWig.
bash proseq2.0.bsh [options]
options:
To get help:
-h, --help Show this brief help menu.
Required options:
-SE, --SEQ=SE Single-end sequencing.
-PE, --SEQ=PE Paired-end sequencing.
-i, --bwa-index=PATH Path to the BWA index of the target genome
(i.e., bwa index).
-c, --chrom-info=PATH Location of the chromInfo table.
I/O options:
-I, --fastq=PREFIX Prefix for input files.
Paired-end files require identical prefix
and end with _R1.fastq.gz and _R2.fastq.gz
eg: PREFIX_R1.fastq.gz, PREFIX_R2.fastq.gz.
-T, --tmp=PATH Path to a temporary storage directory.
-O, --output-dir=DIR Specify a directory to store output in.
Required options for SE
-G, --SE_READ=RNA_5prime Single-end sequencing from 5' end of
nascent RNA, like GRO-seq.
-P, --SE_READ=RNA_3prime Single-end sequencing from 3' end of
nascent RNA, like PRO-seq.
Options for PE
--RNA5=R1_5prime Specify the location of the 5' end of RNA
[default: R1_5prime].
--RNA3=R2_5prime Specify the location of the 3' end of RNA
[default: R2_5prime].
Available options: R1_5prime: the 5' end of R1 reads
R2_5prime: the 5' end of R2 reads
-5, --map5=TRUE Report the 5' end of RNA [default on, --map5=TRUE].
-3, --map5=FALSE Report the 3' end of RNA,
only available for PE [default off, --map5=TRUE].
-s, --opposite-strand=TRUE
Enable this option if the RNA are at the different strand
as the reads set at RNA5 [default: disable].
Optional operations:
--ADAPT_SE=TGGAATTCTCGGGTGCCAAGG
3' adapter to be removed from the 3' end of SE reads.
[default:TGGAATTCTCGGGTGCCAAGG]
--ADAPT1=GATCGTCGGACTGTAGAACTCTGAACG
3' adapter to be removed from the 3' end of R2.
[default:GATCGTCGGACTGTAGAACTCTGAACG]
--ADAPT2=AGATCGGAAGAGCACACGTCTGAACTC
3' adapter to be removed from the 3' end of R1.
[default:AGATCGGAAGAGCACACGTCTGAACTC]
--UMI1=0 The length of UMI barcode on the 5' of R1 read.
[default: 0]
--UMI2=0 The length of UMI barcode on the 5' of R2 read.
[default: 0]
When UMI1 or UMI2 are set > 0, the pipeline will perform PCR deduplicate.
--Force_deduplicate=FALSE
When --Force_deduplicate=TRUE, it will force the pipeline to
perform PCR deduplicate even there is no UMI barcode
(i.e. UMI1=0 and UMI2=0). [default: FALSE]
--ADD_B1=0 The length of additional barcode that will be trimmed
on the 5' of R1 read. [default: 0]
--ADD_B2=0 The length of additional barcode that will be trimmed
on the 5' of R2 read. [default: 0]
--thread=1 Number of threads can be used [default: 1]
-4DREG Using the pre-defined parameters to get the most reads
for dREG package. Please use this flag to make the bigWig
files compatible with dREG algorithm. [default: off, only available to SE]
-aln Use BWA-backtrack [default: SE uses BWA-backtrack (aln), PE uses BWA-MEM (mem)]
-mem Use BWA-MEM [default: SE uses BWA-backtrack (aln), PE uses BWA-MEM (mem)]
In order to process data with proseq, one needs to set the following environment variables: bwaIndex variable points to the location of the genome FASTA file (It is assumed that the genome bwa index files are located in the same folder as the genome FASTA file); and
chromInfo variable points to the location of the .chromInfo file.
For example:
[user@cn3335 ~]$export bwaIndex=/fdb/bwa/indexes/mm10.fa [user@cn3335 ~]$export chromInfo=./mm10.chromInfoFor prosessing of the single-read data, it is also helpful to set the PREFIX variable to the initial part of the data file name, before the ".fastq.gz" string. The commands below will perform processing of the file test_SE.fastq.gz on the assumptuion that the data was generated according to the GRO-seq protocol, i.e. from 5' end of nascent RNA:
[user@cn3335 ~]$PREFIX=test_SE [user@cn3335 ~]$proseq2 -i $bwaIndex -c $chromInfo -SE -G -T myOutput1 -O myOutput1 --UMI1=6 -I $PREFIX Processing PRO-seq data ... Command line parameters: -i /fdb/bwa/indexes/mm10.fa -c ./mm10.chromInfo -SE -G -T myOutput1 -O myOutput1 --UMI1=6 -I test_SE SEQ SE SE_OUTPUT G SE_READ RNA_5prime Report 5' ends TRUE Report opposite strand FALSE Input files/ paths: bwa index /fdb/bwa/indexes/mm10.fa chromInfo ./mm10.chromInfo input file 1 test_SE.fastq.gz temp folder myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu output-dir myOutput1 Optional operations: ADAPT_SE TGGAATTCTCGGGTGCCAAGG ADAPT1 GATCGTCGGACTGTAGAACTCTGAACG ADAPT2 AGATCGGAAGAGCACACGTCTGAACTC UMI1 barcode length 6 UMI2 barcode length 0 ADD_B1 length 0 ADD_B2 length 0 number of threads 1 Remove PCR duplicates TRUE Preprocessing fastq files: This is cutadapt 1.18 with Python 3.6.6 Command line parameters: -a TGGAATTCTCGGGTGCCAAGG -e 0.10 --overlap 2 --output=myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu/test_SE_trim.fastq --untrimmed-output=myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu/test_SE_untrim.fastq test_SE.fastq.gz Processing reads on 1 core in single-end mode ... Finished in 0.23 s (12 us/read; 5.20 M reads/minute). === Summary === Total reads processed: 20,000 Reads with adapters: 481 (2.4%) Reads written (passing filters): 481 (2.4%) Total basepairs processed: 820,000 bp Total written (filtered): 18,583 bp (2.3%) === Adapter 1 === Sequence: TGGAATTCTCGGGTGCCAAGG; Type: regular 3'; Length: 21; Trimmed: 481 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-21 bp: 2 Bases preceding removed adapters: A: 20.8% C: 28.7% G: 23.3% T: 27.2% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 2 359 1250.0 0 359 3 81 312.5 0 81 4 31 78.1 0 31 5 7 19.5 0 7 6 3 4.9 0 3 This is cutadapt 1.18 with Python 3.6.6 Command line parameters: --minimum-length=10 myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu/test_SE_untrim.fastq --output=myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu/test_SE_q20trim.fastq -q 20 Processing reads on 1 core in single-end mode ... This is cutadapt 1.18 with Python 3.6.6 Command line parameters: --cut -0 --minimum-length=10 myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu/test_SE_trim.fastq --output=myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu/test_SE_trim.0Nremoved.fastq -q 20 Processing reads on 1 core in single-end mode ... Finished in 0.01 s (30 us/read; 2.00 M reads/minute). === Summary === Total reads processed: 481 Reads with adapters: 0 (0.0%) Reads that were too short: 0 (0.0%) Reads written (passing filters): 481 (100.0%) Total basepairs processed: 18,583 bp Quality-trimmed: 7 bp (0.0%) Total written (filtered): 18,576 bp (100.0%) Finished in 0.14 s (7 us/read; 8.13 M reads/minute). === Summary === Total reads processed: 19,519 Reads with adapters: 0 (0.0%) Reads that were too short: 0 (0.0%) Reads written (passing filters): 19,519 (100.0%) Total basepairs processed: 800,279 bp Quality-trimmed: 1,070 bp (0.1%) Total written (filtered): 799,209 bp (99.9%) Input and filter stats: Input sequences: 20,000 Input bases: 599,996 Input mean length: 30.00 Good sequences: 7,337 (36.69%) Good bases: 220,106 Good mean length: 30.00 Bad sequences: 12,663 (63.31%) Bad bases: 379,890 Bad mean length: 30.00 Sequences filtered by specified parameters: derep: 12663 Input and filter stats: Input sequences: 7,337 Input bases: 299,331 Input mean length: 40.80 Good sequences: 7,337 (100.00%) Good bases: 255,309 Good mean length: 34.80 Bad sequences: 0 (0.00%) Sequences filtered by specified parameters: none Input and filter stats: Input sequences: 7,337 Input bases: 255,309 Input mean length: 34.80 Good sequences: 7,337 (100.00%) Good bases: 255,309 Good mean length: 34.80 Bad sequences: 0 (0.00%) Sequences filtered by specified parameters: none Mapping reads: [bwa_aln] 17bp reads: max_diff = 2 [bwa_aln] 38bp reads: max_diff = 3 [bwa_aln] 64bp reads: max_diff = 4 [bwa_aln] 93bp reads: max_diff = 5 [bwa_aln] 124bp reads: max_diff = 6 [bwa_aln] 157bp reads: max_diff = 7 [bwa_aln] 190bp reads: max_diff = 8 [bwa_aln] 225bp reads: max_diff = 9 proseq[bwa_aln_core] calculate SA coordinate... 3.69 sec [bwa_aln_core] write to the disk... 0.00 sec [bwa_aln_core] 7337 sequences have been processed. [main] Version: 0.7.17-r1188 [bwa_aln_core] convert to sequence coordinate... [main] CMD: bwa aln -t 1 /fdb/bwa/indexes/mm10.fa myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu/passQC/test_SE_dedup_QC_end.fastq.gz [main] Real time: 10.575 sec; CPU: 5.597 sec 2.53 sec [bwa_aln_core] refine gapped alignments... 0.47 sec [bwa_aln_core] print alignments... 0.00 sec [bwa_aln_core] 7337 sequences have been processed. [main] Version: 0.7.17-r1188 [main] CMD: bwa samse -n 1 -f myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu/passQC/test_SE_dedup_QC_end.sam /fdb/bwa/indexes/mm10.fa - myOutput1/uABGgL8Bm4K70nNZppSsTdbkzFgkmYYu/passQC/test_SE_dedup_QC_end.fastq.gz [main] Real time: 17.078 sec; CPU: 3.023 secThe results will be stored in the folder myOutput1.
The next set of commands will process tha same data file on the assumption it was generated according to the PRO-seq protocol (from 3' end of nascent RNA):
[user@cn3335 ~]$PREFIX=test_SE [user@cn3335 ~]$proseq2 -i $bwaIndex -c $chromInfo -SE -P -T myOutput2 -O myOutput2 --UMI1=6 -I $PREFIX Processing PRO-seq data ... Command line parameters: -i /fdb/bwa/indexes/mm10.fa -c ./mm10.chromInfo -SE -P -T myOutput2 -O myOutput2 --UMI1=6 -I test_SE SEQ SE SE_OUTPUT P SE_READ RNA_3prime Report 5' ends TRUE Report opposite strand TRUE Input files/ paths: bwa index /fdb/bwa/indexes/mm10.fa chromInfo ./mm10.chromInfo input file 1 test_SE.fastq.gz temp folder myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr output-dir myOutput2 Optional operations: ADAPT_SE TGGAATTCTCGGGTGCCAAGG ADAPT1 GATCGTCGGACTGTAGAACTCTGAACG ADAPT2 AGATCGGAAGAGCACACGTCTGAACTC UMI1 barcode length 6 UMI2 barcode length 0 ADD_B1 length 0 ADD_B2 length 0 number of threads 1 Remove PCR duplicates TRUE Preprocessing fastq files: This is cutadapt 1.18 with Python 3.6.6 Command line parameters: -a TGGAATTCTCGGGTGCCAAGG -e 0.10 --overlap 2 --output=myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr/test_SE_trim.fastq --untrimmed-output=myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr/test_SE_untrim.fastq test_SE.fastq.gz Processing reads on 1 core in single-end mode ... Finished in 0.23 s (11 us/read; 5.33 M reads/minute). === Summary === Total reads processed: 20,000 Reads with adapters: 481 (2.4%) Reads written (passing filters): 481 (2.4%) Total basepairs processed: 820,000 bp Total written (filtered): 18,583 bp (2.3%) === Adapter 1 === Sequence: TGGAATTCTCGGGTGCCAAGG; Type: regular 3'; Length: 21; Trimmed: 481 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-21 bp: 2 Bases preceding removed adapters: A: 20.8% C: 28.7% G: 23.3% T: 27.2% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 2 359 1250.0 0 359 3 81 312.5 0 81 4 31 78.1 0 31 5 7 19.5 0 7 6 3 4.9 0 3 This is cutadapt 1.18 with Python 3.6.6 Command line parameters: --minimum-length=10 myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr/test_SE_untrim.fastq --output=myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr/test_SE_q20trim.fastq -q 20 Processing reads on 1 core in single-end mode ... This is cutadapt 1.18 with Python 3.6.6 Command line parameters: --cut -0 --minimum-length=10 myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr/test_SE_trim.fastq --output=myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr/test_SE_trim.0Nremoved.fastq -q 20 Processing reads on 1 core in single-end mode ... Finished in 0.01 s (30 us/read; 2.03 M reads/minute). === Summary === Total reads processed: 481 Reads with adapters: 0 (0.0%) Reads that were too short: 0 (0.0%) Reads written (passing filters): 481 (100.0%) Total basepairs processed: 18,583 bp Quality-trimmed: 7 bp (0.0%) Total written (filtered): 18,576 bp (100.0%) Finished in 0.14 s (7 us/read; 8.27 M reads/minute). === Summary === Total reads processed: 19,519 Reads with adapters: 0 (0.0%) Reads that were too short: 0 (0.0%) Reads written (passing filters): 19,519 (100.0%) Total basepairs processed: 800,279 bp Quality-trimmed: 1,070 bp (0.1%) Total written (filtered): 799,209 bp (99.9%) Input and filter stats: Input sequences: 20,000 Input bases: 599,996 Input mean length: 30.00 Good sequences: 7,337 (36.69%) Good bases: 220,106 Good mean length: 30.00 Bad sequences: 12,663 (63.31%) Bad bases: 379,890 Bad mean length: 30.00 Sequences filtered by specified parameters: derep: 12663 Input and filter stats: Input sequences: 7,337 Input bases: 299,331 Input mean length: 40.80 Good sequences: 7,337 (100.00%) Good bases: 255,309 Good mean length: 34.80 Bad sequences: 0 (0.00%) Sequences filtered by specified parameters: none Input and filter stats: Input sequences: 7,337 Input bases: 255,309 Input mean length: 34.80 Good sequences: 7,337 (100.00%) Good bases: 255,309 Good mean length: 34.80 Bad sequences: 0 (0.00%) Sequences filtered by specified parameters: none Mapping reads: [bwa_aln] 17bp reads: max_diff = 2 [bwa_aln] 38bp reads: max_diff = 3 [bwa_aln] 64bp reads: max_diff = 4 [bwa_aln] 93bp reads: max_diff = 5 [bwa_aln] 124bp reads: max_diff = 6 [bwa_aln] 157bp reads: max_diff = 7 [bwa_aln] 190bp reads: max_diff = 8 [bwa_aln] 225bp reads: max_diff = 9 [bwa_aln_core] calculate SA coordinate... 3.73 sec [bwa_aln_core] write to the disk... 0.00 sec [bwa_aln_core] 7337 sequences have been processed. [main] Version: 0.7.17-r1188 [bwa_aln_core] convert to sequence coordinate... [main] CMD: bwa aln -t 1 /fdb/bwa/indexes/mm10.fa myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr/passQC/test_SE_dedup_QC_end.fastq.gz [main] Real time: 4.971 sec; CPU: 4.944 sec 2.08 sec [bwa_aln_core] refine gapped alignments... 0.31 sec [bwa_aln_core] print alignments... 0.00 sec [bwa_aln_core] 7337 sequences have been processed. [main] Version: 0.7.17-r1188 [main] CMD: bwa samse -n 1 -f myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr/passQC/test_SE_dedup_QC_end.sam /fdb/bwa/indexes/mm10.fa - myOutput2/hmAk4XuYQ4tnRxpC4V6fToiPSGIasBRr/passQC/test_SE_dedup_QC_end.fastq.gz [main] Real time: 7.402 sec; CPU: 2.414 sec Writing bigWigs: ...The output will stored in the folder myOutput2.
Finally, the commands below will allow processing the paired-end data. For this purpose, the PREFIX variable should be set to the initial part of the data files name, before the strings "_R1.fastq.gz" or "_R2.fastq.gz":
[user@cn3335 ~]$ PREFIX=test [user@cn3335 ~]$ proseq2 -i $bwaIndex -c $chromInfo -PE --RNA3=R1_5prime -T myOutput3 -O myOutput3 -I $PREFIX --UMI1=6 --ADAPT1=GATCGTCGGACTGTAGAACTCTGAAC --ADAPT2=TGGAATTCTCGGGTGCCAAGG Processing PRO-seq data ... Command line parameters: -i /fdb/bwa/indexes/mm10.fa -c ./mm10.chromInfo -PE --RNA3=R1_5prime -T myOutput3 -O myOutput3 -I test --UMI1=6 --ADAPT1=GATCGTCGGACTGTAGAACTCTGAAC --ADAPT2=TGGAATTCTCGGGTGCCAAGG SEQ PE Location of 5' of RNA R2_5prime Location of 3' of RNA R1_5prime Report 5' ends TRUE Report opposite strand FALSE Input files/ paths: bwa index /fdb/bwa/indexes/mm10.fa chromInfo ./mm10.chromInfo input file pair 1 test_R1.fastq.gz, test_R2.fastq.gz temp folder myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI output-dir myOutput3 Optional operations: ADAPT_SE TGGAATTCTCGGGTGCCAAGG ADAPT1 GATCGTCGGACTGTAGAACTCTGAAC ADAPT2 TGGAATTCTCGGGTGCCAAGG UMI1 barcode length 6 UMI2 barcode length 0 ADD_B1 length 0 ADD_B2 length 0 number of threads 1 Remove PCR duplicates TRUE Preprocessing fastq files: This is cutadapt 1.18 with Python 3.6.6 Command line parameters: -a GATCGTCGGACTGTAGAACTCTGAAC -e 0.10 --overlap 2 --output=myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_trim_R2.fastq --untrimmed-output=myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_untrim_R2.fastq test_R2.fastq.gz Processing reads on 1 core in single-end mode ... This is cutadapt 1.18 with Python 3.6.6 Command line parameters: -a TGGAATTCTCGGGTGCCAAGG -e 0.10 --overlap 2 --output=myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_trim_R1.fastq --untrimmed-output=myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_untrim_R1.fastq test_R1.fastq.gz Processing reads on 1 core in single-end mode ... Finished in 0.42 s (21 us/read; 2.84 M reads/minute). === Summary === Total reads processed: 20,000 Reads with adapters: 481 (2.4%) Reads written (passing filters): 481 (2.4%) Total basepairs processed: 820,000 bp Total written (filtered): 18,583 bp (2.3%) === Adapter 1 === Sequence: TGGAATTCTCGGGTGCCAAGG; Type: regular 3'; Length: 21; Trimmed: 481 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-21 bp: 2 Bases preceding removed adapters: A: 20.8% C: 28.7% G: 23.3% T: 27.2% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 2 359 1250.0 0 359 3 81 312.5 0 81 4 31 78.1 0 31 5 7 19.5 0 7 6 3 4.9 0 3 Finished in 0.52 s (26 us/read; 2.33 M reads/minute). === Summary === Total reads processed: 20,000 Reads with adapters: 15,088 (75.4%) Reads written (passing filters): 15,088 (75.4%) Total basepairs processed: 820,000 bp Total written (filtered): 83,894 bp (10.2%) === Adapter 1 === Sequence: GATCGTCGGACTGTAGAACTCTGAAC; Type: regular 3'; Length: 26; Trimmed: 15088 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-26 bp: 2 Bases preceding removed adapters: A: 4.1% C: 4.4% G: 7.6% T: 6.4% none/other: 77.5% Overview of removed sequences length count expect max.err error counts 2 357 1250.0 0 357 3 245 312.5 0 245 4 238 78.1 0 238 5 209 19.5 0 209 6 161 4.9 0 161 7 174 1.2 0 174 8 134 0.3 0 134 9 94 0.1 0 94 10 63 0.0 1 60 3 11 33 0.0 1 32 1 12 34 0.0 1 33 1 13 30 0.0 1 27 3 14 20 0.0 1 20 15 21 0.0 1 20 1 16 17 0.0 1 17 17 18 0.0 1 15 3 18 18 0.0 1 18 19 15 0.0 1 15 20 25 0.0 2 24 1 21 18 0.0 2 17 0 1 22 18 0.0 2 17 1 23 14 0.0 2 13 1 24 20 0.0 2 19 1 25 13 0.0 2 10 2 1 26 13 0.0 2 13 27 761 0.0 2 707 41 13 28 36 0.0 2 36 29 10 0.0 2 9 1 30 22 0.0 2 21 1 31 22 0.0 2 22 32 13 0.0 2 13 33 434 0.0 2 403 21 10 34 3 0.0 2 3 35 20 0.0 2 18 2 36 4 0.0 2 4 37 50 0.0 2 49 1 38 2 0.0 2 2 39 1 0.0 2 1 40 10 0.0 2 10 41 11698 0.0 2 11251 312 135 This is cutadapt 1.18 with Python 3.6.6 Command line parameters: --minimum-length=10 myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_untrim_R1.fastq --output=myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_q20trim_R1.fastq -q 20 Processing reads on 1 core in single-end mode ... This is cutadapt 1.18 with Python 3.6.6 Command line parameters: --cut -0 --minimum-length=10 myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_trim_R1.fastq --output=myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_trim.0Nremoved_R1.fastq -q 20 Processing reads on 1 core in single-end mode ... Finished in 0.01 s (29 us/read; 2.07 M reads/minute). === Summary === Total reads processed: 481 Reads with adapters: 0 (0.0%) Reads that were too short: 0 (0.0%) Reads written (passing filters): 481 (100.0%) Total basepairs processed: 18,583 bp Quality-trimmed: 7 bp (0.0%) Total written (filtered): 18,576 bp (100.0%) Finished in 0.21 s (11 us/read; 5.47 M reads/minute). === Summary === Total reads processed: 19,519 Reads with adapters: 0 (0.0%) Reads that were too short: 0 (0.0%) Reads written (passing filters): 19,519 (100.0%) Total basepairs processed: 800,279 bp Quality-trimmed: 1,070 bp (0.1%) Total written (filtered): 799,209 bp (99.9%) This is cutadapt 1.18 with Python 3.6.6 Command line parameters: --minimum-length=10 myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_untrim_R2.fastq --output=myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_q20trim_R2.fastq -q 20 Processing reads on 1 core in single-end mode ... This is cutadapt 1.18 with Python 3.6.6 Command line parameters: --cut -6 --minimum-length=10 myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_trim_R2.fastq --output=myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/test_trim.6Nremoved_R2.fastq -q 20 Processing reads on 1 core in single-end mode ... Finished in 0.07 s (13 us/read; 4.52 M reads/minute). === Summary === Total reads processed: 4,912 Reads with adapters: 0 (0.0%) Reads that were too short: 117 (2.4%) Reads written (passing filters): 4,795 (97.6%) Total basepairs processed: 201,392 bp Quality-trimmed: 7,497 bp (3.7%) Total written (filtered): 193,414 bp (96.0%) Finished in 0.17 s (12 us/read; 5.21 M reads/minute). === Summary === Total reads processed: 15,088 Reads with adapters: 0 (0.0%) Reads that were too short: 13,106 (86.9%) Reads written (passing filters): 1,982 (13.1%) Total basepairs processed: 83,894 bp Quality-trimmed: 432 bp (0.5%) Total written (filtered): 55,714 bp (66.4%) cat: myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/noadapt/l30_nodups/test_dedup_2_singletons.fastq: No such file or directory rm: cannot remove ‘myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/noadapt/l30_nodups/test_dedup_2_singletons.fastq’: No such file or directory Input and filter stats: Input sequences (file 1): 20,000 Input bases (file 1): 599,996 Input mean length (file 1): 30.00 Input sequences (file 2): 6,777 Input bases (file 2): 197,076 Input mean length (file 2): 29.08 Good sequences (pairs): 6,230 Good bases (pairs): 369,588 Good mean length (pairs): 59.32 Good sequences (singletons file 1): 1,404 (7.02%) Good bases (singletons file 1): 42,116 Good mean length (singletons file 1): 30.00 Good sequences (singletons file 2): 0 (0.00%) Bad sequences (file 1): 12,366 (61.83%) Bad bases (file 1): 370,980 Bad mean length (file 1): 30.00 Bad sequences (file 2): 98 (1.45%) Bad bases (file 2): 1,179 Bad mean length (file 2): 12.03 Sequences filtered by specified parameters: min_len: 111 derep: 12366 Input and filter stats: Input sequences: 6,230 Input bases: 230,343 Input mean length: 36.97 Good sequences: 6,230 (100.00%) Good bases: 230,343 Good mean length: 36.97 Bad sequences: 0 (0.00%) Sequences filtered by specified parameters: none Input and filter stats: Input sequences: 6,230 Input bases: 254,025 Input mean length: 40.77 Good sequences: 6,230 (100.00%) Good bases: 216,645 Good mean length: 34.77 Bad sequences: 0 (0.00%) Sequences filtered by specified parameters: none Input and filter stats: Input sequences (file 1): 6,230 Input bases (file 1): 216,645 Input mean length (file 1): 34.77 Input sequences (file 2): 6,230 Input bases (file 2): 230,343 Input mean length (file 2): 36.97 Good sequences (pairs): 6,230 Good bases (pairs): 446,988 Good mean length (pairs): 71.75 Good sequences (singletons file 1): 0 (0.00%) Good sequences (singletons file 2): 0 (0.00%) Bad sequences (file 1): 0 (0.00%) Bad sequences (file 2): 0 (0.00%) Sequences filtered by specified parameters: none Mapping reads: [M::bwa_idx_load_from_disk] read 0 ALT contigs [M::process] read 12460 sequences (446988 bp)... [M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 3068, 0, 0) [M::mem_pestat] skip orientation FF as there are not enough pairs [M::mem_pestat] analyzing insert size distribution for orientation FR... [M::mem_pestat] (25, 50, 75) percentile: (29, 36, 49) [M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 89) [M::mem_pestat] mean and std.dev: (40.00, 14.74) [M::mem_pestat] low and high boundaries for proper pairs: (1, 109) [M::mem_pestat] skip orientation RF as there are not enough pairs [M::mem_pestat] skip orientation RR as there are not enough pairs [M::mem_process_seqs] Processed 12460 reads in 1.840 CPU sec, 1.846 real sec [main] Version: 0.7.17-r1188 [main] CMD: bwa mem -k 19 -t 1 /fdb/bwa/indexes/mm10.fa myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/passQC/test_dedup_QC_end_1.fastq.gz myOutput3/DnA5iYF6dbDZRzwfLnnMjbkNubF5SMBI/passQC/test_dedup_QC_end_2.fastq.gz [main] Real time: 4.736 sec; CPU: 4.618 sec Writing bigWigs: ...The results will stored in the folder myOutput3.