randfold on Biowulf
Randfold computes the probability that, for a given RNA sequence, the Minimum Free Energy (MFE) of the secondary structure is different from a distribution of MFE computed with random sequences obtained by permuting the input sequence.
References:
Documentation
Important Notes
- Module Name: randfold (see the modules page for more information)
Interactive job
Interactive jobs should be used for debugging, graphics, or applications that cannot be run as batch jobs.
Allocate an interactive session.
[user@biowulf]$ sinteractive salloc.exe: Pending job allocation 46116226 salloc.exe: job 46116226 queued and waiting for resources salloc.exe: job 46116226 has been allocated resources salloc.exe: Granted job allocation 46116226 salloc.exe: Waiting for resource configuration salloc.exe: Nodes cn3144 are ready for job [user@cn3144]$ module load randfold
Example: running randfold on a single miRNA sequence
[user@cn3144]$ randfold FATAL: Usage: randfold <method> <file name> <number of randomizations> methods: -s simple mononucleotide shuffling -d dinucleotide shuffling -m markov chain 1 shuffling Example: randfold -d let7.tfa 999 [user@cn3144]$ cat > cel-let7.fa <<EOF >cel-let-7 Caenorhabditis elegans let-7 precursor RNA UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC UAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA EOF [user@cn3144]$ randfold -d cel-let7.fa 999 cel-let-7 -42.90 0.001000
Running randfold on a set of mouse miRNA sequences in series (randfold will process one sequence at a time).
[user@cn3144]$ wget "ftp://mirbase.org/pub/mirbase/CURRENT/hairpin.fa.gz"
[user@cn3144]$ gunzip hairpin.fa.gz
[user@cn3144]$ awk '/^>/ {p=0} /^>mmu/{p=1} p==1' hairpin.fa > mouse_hairpin.fa
[user@cn3144]$ randfold -d mouse_hairpin.fa 99 > mouse_hairpin.randfold
End the interactive session
[user@cn3144]$ exit salloc.exe: Relinquishing job allocation 46116226 [user@biowulf]$
Batch job
Most jobs should be run as batch jobs.
Create a batch input file (e.g. randfold.sh), which uses the input file 'randfold.in'. For example:
#! /bin/bash #SBATCH --job-name=randfold set -e module load randfold inf=/data/$USER/test_data/randfold/mouse_hairpins.fa outf=/data/$USER/test_data/randfold/mouse_hairpins.fa.randfold randfold -d $inf 99 > $outf
Submit this job using the Slurm sbatch command.
sbatch randfold.sh
Swarm of Jobs
A swarm of jobs is an easy way to submit a set of independent commands requiring identical resources.
Create a swarmfile (e.g. randfold.swarm). For example:
randfold -d mouse_hairpins/mmu-let-7a-1.fasta 999 > mouse_hairpins/mmu-let-7a-1.fasta.randfold randfold -d mouse_hairpins/mmu-let-7a-2.fasta 999 > mouse_hairpins/mmu-let-7a-2.fasta.randfold randfold -d mouse_hairpins/mmu-let-7b.fasta 999 > mouse_hairpins/mmu-let-7b.fasta.randfold
Submit this job using the swarm command.
swarm -f randfold.swarm --module randfoldwhere
| -g # | Number of Gigabytes of memory required for each process (1 line in the swarm command file) |
| -t # | Number of threads/CPUs required for each process (1 line in the swarm command file). |
| --module randfold | Loads the randfold module for each subjob in the swarm |