• Source and supplemental data

• Module Name: randfold (see the modules page for more information)

Allocate an interactive session.

[user@biowulf]$ sinteractive
salloc.exe: Pending job allocation 46116226
salloc.exe: job 46116226 queued and waiting for resources
salloc.exe: job 46116226 has been allocated resources
salloc.exe: Granted job allocation 46116226
salloc.exe: Waiting for resource configuration
salloc.exe: Nodes cn3144 are ready for job

[user@cn3144]$ module load randfold

Example: running randfold on a single miRNA sequence

[user@cn3144]$ randfold
FATAL: Usage: randfold <method> <file name> <number of randomizations>

methods:
-s simple mononucleotide shuffling
-d dinucleotide shuffling
-m markov chain 1 shuffling

Example: randfold -d let7.tfa 999

[user@cn3144]$ cat > cel-let7.fa <<EOF
>cel-let-7 Caenorhabditis elegans let-7 precursor RNA
UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC
UAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA
EOF
[user@cn3144]$ randfold -d cel-let7.fa 999
cel-let-7       -42.90  0.001000

Running randfold on a set of mouse miRNA sequences in series (randfold will process one sequence at a time).

[user@cn3144]$ wget "ftp://mirbase.org/pub/mirbase/CURRENT/hairpin.fa.gz"
[user@cn3144]$ gunzip hairpin.fa.gz
[user@cn3144]$ awk '/^>/ {p=0} /^>mmu/{p=1} p==1' hairpin.fa > mouse_hairpin.fa
[user@cn3144]$ randfold -d mouse_hairpin.fa 99 > mouse_hairpin.randfold

End the interactive session

[user@cn3144]$ exit
salloc.exe: Relinquishing job allocation 46116226
[user@biowulf]$

Create a batch input file (e.g. randfold.sh), which uses the input file 'randfold.in'. For example:

#! /bin/bash
#SBATCH --job-name=randfold
set -e

module load randfold
inf=/data/$USER/test_data/randfold/mouse_hairpins.fa
outf=/data/$USER/test_data/randfold/mouse_hairpins.fa.randfold
randfold -d $inf 99 > $outf

Submit this job using the Slurm sbatch command.

sbatch randfold.sh

Create a swarmfile (e.g. randfold.swarm). For example:

randfold -d mouse_hairpins/mmu-let-7a-1.fasta 999 > mouse_hairpins/mmu-let-7a-1.fasta.randfold
randfold -d mouse_hairpins/mmu-let-7a-2.fasta 999 > mouse_hairpins/mmu-let-7a-2.fasta.randfold
randfold -d mouse_hairpins/mmu-let-7b.fasta 999 > mouse_hairpins/mmu-let-7b.fasta.randfold

Submit this job using the swarm command.

swarm -f randfold.swarm --module randfold