Seqkit is a rapid tool for manipulating fasta and fastq files. It includes a number of different tools: format conversion, searching, bam processing and monitoring, filtering and ordering. SeqKit demonstrates competitive performance in execution time and memory usage compared to similar tools.
$SEQKIT_TEST_DATA-j/--threads. Please match
the number of allocated CPUs to the number of threads.Allocate an interactive session and run the program. Sample session:
[user@biowulf]$ sinteractive salloc.exe: Pending job allocation 46116226 salloc.exe: job 46116226 queued and waiting for resources salloc.exe: job 46116226 has been allocated resources salloc.exe: Granted job allocation 46116226 salloc.exe: Waiting for resource configuration salloc.exe: Nodes cn3144 are ready for job [user@cn3144]$ module load seqkit [user@cn3144]$ seqkit help seqKit -- a cross-platform and ultrafast toolkit for FASTA/Q file manipulation Version: 0.12.1 Author: Wei ShenDocuments : http://bioinf.shenwei.me/seqkit Source code: https://github.com/shenwei356/seqkit Please cite: https://doi.org/10.1371/journal.pone.0163962 Usage: seqkit [command] Available Commands: amplicon retrieve amplicon (or specific region around it) via primer(s) bam monitoring and online histograms of BAM record features common find common sequences of multiple files by id/name/sequence concat concatenate sequences with same ID from multiple files convert convert FASTQ quality encoding between Sanger, Solexa and Illumina duplicate duplicate sequences N times faidx create FASTA index file and extract subsequence fish look for short sequences in larger sequences using local alignment fq2fa convert FASTQ to FASTA fx2tab convert FASTA/Q to tabular format (with length/GC content/GC skew) genautocomplete generate shell autocompletion script grep search sequences by ID/name/sequence/sequence motifs, mismatch allowed head print first N FASTA/Q records help Help about any command locate locate subsequences/motifs, mismatch allowed mutate edit sequence (point mutation, insertion, deletion) range print FASTA/Q records in a range (start:end) rename rename duplicated IDs replace replace name/sequence by regular expression restart reset start position for circular genome rmdup remove duplicated sequences by id/name/sequence sample sample sequences by number or proportion sana sanitize broken single line fastq files seq transform sequences (revserse, complement, extract ID...) shuffle shuffle sequences sliding sliding sequences, circular genome supported sort sort sequences by id/name/sequence/length split split sequences into files by id/seq region/size/parts (mainly for FASTA) split2 split sequences into files by size/parts (FASTA, PE/SE FASTQ) stats simple statistics of FASTA/Q files subseq get subsequences by region/gtf/bed, including flanking sequences tab2fx convert tabular format to FASTA/Q format translate translate DNA/RNA to protein sequence (supporting ambiguous bases) version print version information and check for update watch monitoring and online histograms of sequence features Flags: --alphabet-guess-seq-length int length of sequence prefix of the first FASTA record based on which seqkit guesses the sequence type (0 for whole seq) (default 10000) -h, --help help for seqkit --id-ncbi FASTA head is NCBI-style, e.g. >gi|110645304|ref|NC_002516.2| Pseud... --id-regexp string regular expression for parsing ID (default "^(\\S+)\\s?") --infile-list string file of input files list (one file per line), if given, they are appended to files from cli arguments -w, --line-width int line width when outputing FASTA format (0 for no wrap) (default 60) -o, --out-file string out file ("-" for stdout, suffix .gz for gzipped out) (default "-") --quiet be quiet and do not show extra information -t, --seq-type string sequence type (dna|rna|protein|unlimit|auto) (for auto, it automatically detect by the first sequence) (default "auto") -j, --threads int number of CPUs. (default value: 1 for single-CPU PC, 2 for others) (default 2) Use "seqkit [command] --help" for more information about a command. [user@cn3144]$ cp $SEQKIT_TEST_DATA/* . [user@cn3144]$ ls -lh total 13M -rw-rw-r-- 1 user group 1.5M Mar 11 2018 hairpin.fa.gz -rw-rw-r-- 1 user group 12M Sep 10 14:51 read1_250k.fastq.gz [user@cn3144]$ seqkit stat hairpin.fa.gz file format type num_seqs sum_len min_len avg_len max_len hairpin.fa.gz FASTA RNA 38,589 3,729,811 39 96.7 2,354 [user@cn3144]$ zcat hairpin.fa.gz|seqkit grep -s -i -p AAUCUUCCUUUGUCU -m 1 >mdo-mir-12331 MI0040833 Monodelphis domestica miR-12331 stem-loop AAUCUUCCUUUGUCUACUUUAAGUUCCUGAUUGACUAACUUAAAAUAGACAAAGUGAGAG UU [user@cn3144]$ gunzip hairpin.fa.gz [user@cn3144]$ seqkit sort --by-length --reverse --two-pass hairpin.fa > hairpin_sorted.fa [user@cn3144]$ seqkit fx2tab --length hairpin_sorted.fa --name --only-id | head atr-MIR8591 2354 eun-MIR10219 1545 atr-MIR8598 1411 aly-MIR858 938 mdm-MIR858 921 mtr-MIR7700 910 cre-MIR914 894 eun-MIR10211a 820 eun-MIR10211b 820 atr-MIR8612 805 [user@cn3144]$ seqkit rmdup -s -i hairpin.fa -o clean.fa.gz -D dups.txt [user@cn3144]$ exit salloc.exe: Relinquishing job allocation 46116226 [user@biowulf]$
Create a batch input file (e.g. seqkit.sh), which uses the input file 'seqkit.in'. For example:
#!/bin/bash module load seqkit || exit 1 seqkit split $SEQKIR_TEST_DATA/hairpin.fa.gz -i --id-regexp "^([\w]+)\-" --two-pass
Submit this job using the Slurm sbatch command.
sbatch --cpus-per-task=2 --mem=4g seqkit.sh
Create a swarmfile (e.g. seqkit.swarm). For example:
seqkit -B -g -G -l -n file1.fa seqkit -B -g -G -l -n file2.fa seqkit -B -g -G -l -n file3.fa
Submit this job using the swarm command.
swarm -f seqkit.swarm -g 4 -t 1 --module seqkitwhere
| -g # | Number of Gigabytes of memory required for each process (1 line in the swarm command file) |
| -t # | Number of threads/CPUs required for each process (1 line in the swarm command file). |
| --module seqkit | Loads the seqkit module for each subjob in the swarm |