Biowulf High Performance Computing at the NIH
Ultraplex on Biowulf

Ultraplex is an application for demultiplexing and processing FASTQ files. The processing steps include removing low quality bases, removing sequencing adaptors, and separating FASTQ using demultiplexing barcodes. Ultraplex is intended for use with custom library preparation protocols instead of commercial prep kits.

Documentation
Important Notes

This application requires a lscratch allocation

Interactive job
Interactive jobs should be used for debugging, graphics, or applications that cannot be run as batch jobs.

Allocate an interactive session and run the program.
Sample session (user input in bold):

[user@biowulf]$ sinteractive --gres=lscratch:10
salloc.exe: Pending job allocation 46116226
salloc.exe: job 46116226 queued and waiting for resources
salloc.exe: job 46116226 has been allocated resources
salloc.exe: Granted job allocation 46116226
salloc.exe: Waiting for resource configuration
salloc.exe: Nodes cn3144 are ready for job

[user@cn3144 ~]$ module load ultraplex
[+] Loading singularity  3.8.5-1  on cn0847
[+] Loading ultraplex 1.2.5  ...

[user@cn3144 ~]$ cd /lscratch/$SLURM_JOB_ID

[user@cn3144 ~]$ cp -r $ULTRAPLEX_TEST_DATA tests

[user@cn3144 ~]$ ultraplex -i tests/reads1.fastq.gz \
                              -i2 tests/reads2.fastq.gz \
                              -b tests/barcodes_5_and_3.csv \
                              -d PE -o paired_end
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
@@@@@   @@@@   .@@   @@@@@@@          @@         @@@@@@    (@@@@@        @@@    @@@@@@@         @@    @@@    @
@@@@   @@@@    @@   ,@@@@@@@@@    @@@@@    @@@   @@@@   (   @@@@   @@@   @@    @@@@@@@   @@@@@@@@@@   #   @@@@
@@@   &@@@    @@    @@@@@@@@@%   @@@@@         @@@@(   @    @@@         @@    @@@@@@@         @@@@@     @@@@@@
@@    @@@    @@    @@@@@@@@@@   @@@@@    @@    @@@          @@   .@@@@@@@*   @@@@@@@    @@@@@@@@.   @    @@@@@
@@@       @@@@.        @@@@@   @@@@@&   @@@.   &   &@@@@    @    @@@@@@@@         @          @    @@@@    @@@@
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@

Namespace(adapter='AGATCGGAAGAGCGGTTCAG', adapter2='AGATCGGAAGAGCGTCGTG', barcodes='tests/barcodes_5_and_3.csv', directory='PE', dont_build_reference=False, final_min_length=20, fiveprimemismatches=1, ignore_no_match=False, ignore_space_warning=False, input_2='tests/reads2.fastq.gz', inputfastq='tests/reads1.fastq.gz', keep_barcode=False, min_trim=3, outputprefix='paired_end', phredquality=30, phredquality_5_prime=0, sbatchcompression=False, threads=4, threeprimemismatches=0, ultra=False)
Demultiplexing...
Demultiplexing complete! 2700 reads processed in 0.0 seconds

[user@cn3144 ~]$ exit
salloc.exe: Relinquishing job allocation 46116226
[user@biowulf ~]$

Batch job
Most jobs should be run as batch jobs.

Create a batch input file (e.g. ultraplex.sh). For example:

#!/bin/bash
set -e
module load ultraplex
ultraplex -i R1.fastq.gz \
          -i2 R2.fastq.gz \
          -b barcods.csv \
          -d PE \
          -t $SLURM_CPUS_PER_TASK
          -o output_dir

Submit this job using the Slurm sbatch command.

sbatch [--cpus-per-task=#] [--mem=#] --gres=lscratch:# ultraplex.sh
Swarm of Jobs
A swarm of jobs is an easy way to submit a set of independent commands requiring identical resources.

Create a swarmfile (e.g. ultraplex.swarm). For example:

ultraplex -t $SLURM_CPUS_PER_TASK -i L1.R1.fastq.gz -i2 L1.R2.fastq.gz -b barcodes.csv -d PE -o L1
ultraplex -t $SLURM_CPUS_PER_TASK -i L2.R1.fastq.gz -i2 L2.R2.fastq.gz -b barcodes.csv -d PE -o L2
ultraplex -t $SLURM_CPUS_PER_TASK -i L3.R1.fastq.gz -i2 L3.R2.fastq.gz -b barcodes.csv -d PE -o L3
ultraplex -t $SLURM_CPUS_PER_TASK -i L4.R1.fastq.gz -i2 L4.R2.fastq.gz -b barcodes.csv -d PE -o L4

Submit this job using the swarm command.

swarm -f ultraplex.swarm [-g #] [-t #] --gres=lscratch:# --module ultraplex
where
-g #Number of Gigabytes of memory required for each process (1 line in the swarm command file)
-t #Number of threads/CPUs required for each process (1 line in the swarm command file).
--gres=lscratch:#lscratch amount in GB allocated for each process (1 line in the swarm command file).
--module ultraplexLoads the Ultraplex module for each subjob in the swarm